Основа для запонок: Основа для запонок – купить на Ярмарке Мастеров

Содержание

Урок. Запонки в экструдерной технике

Сегодня у нас простой урок - как сделать запонки в экструдерной технике. За основу можно взять не только запонки, но и основу для подвески или серёг. В качестве наполнения можно использовать остатки от экструдерных колбас.

Для работы потребуются следующие материалы:

1. Основы для запонок (основы для подвески, серёг или кольцав наличии в магазине craftband.ru)

2. Гель для полимерной глины( в наличии в магазине craftband.ru).

3. Остатки экструдерных колбас или выполните новые, используя наш урок.

4. Пласт полимерной глины для подложки изделия. Можно смешать из остатков глины.

5. Паста-машина, ролик для полимерной глины.

6. Лезвия для полимерной глины.

Приступим!

1.Выбираем настройку на паста - машине и раскатываем пласт. Автор урока раскатывает на большой толщине. Намечаем контур изделия, используя основу для запонок. Переварачиваем пласт так, чтобы контуры оказались на обратной стороне пласта.

2. Используя лезвие для полимерной глины, нарезаем экструдерные колбасы.

3. Экструдерные срезы помещаем на обратную сторону намеченных контуров. Аккуратно прижимаем срезы к основе, избегая образования пузырьков воздуха.

4. Основами для запонок продавливаем контур, стараясь попасть в намеченный раннее контур на обратной стороне пласта.

5. Основами для запонок выдавливаем рисунок с обратной стороны.

6. Аккуратно отделяем круги от пласта.

7. Помещаем круги в основы и выравниваем края. Я бы сразу и запекла, но автор запекает заготовки из глины (25 минут при 140 градусах) отдельно от изделия.

8. Запечённые круги шлифуем. На основу для запонок наносим по капле геля для полимерной глины. Помещаем круги на основу для запонок. Запекаем 10 минут при температуре 140 градусов).

9. Готово!. Шлифуем и лакируем, если это необходимо.

Благодарим за разрешение опубликовать этот урок Запонки в экструдерной технике авторам - creativepolymerartcenter.com.

С уважением, Жанна craftband.ru

инструкция и полезные советы для мужчин

Что такое запонки

Современный мужской костюм невозможно представить без каких-либо аксессуаров и украшений. Будь то часы, зажим для галстука, авторучка или запонки. А что такое запонки, что они из себя представляют и какова история их возникновения? На эти и другие вопросы мы постараемся ответить ниже.

Смотреть все золотые запонки в каталоге Sunlight

Мужские запонки выглядят такими, какими мы знаем их сейчас, лишь с 19 века. Задолго до этого мужчины подвязывали манжеты сорочек лентами и шнурками, что создавало свои неудобства по причине того, что они постоянно развязывались и легко пачкались. C подачи Людовика XIV модники закалывали манжеты двумя одинаковыми пуговицами, а их скрепляла короткая цепочка. Чуть позже это простое и функциональное украшение становится более изысканным, при изготовлении используют драгоценные камни и металлы. Производство было довольно дорогим, поэтому не каждый мог себе их позволить, появились изделия из более простых материалов с покрытием позолотой. Но окончательный облик и распространение запонкам дал американец Джордж Кременц, сумевший создать аппарат, который позволил производить их очень дешево и в большом количестве. А в 1924 году компания «Boyer» изобрела и запатентовала новый механизм застежки, который используется и по сей день в большинстве запонок.

Смотреть все серебряные запонки в каталоге Sunlight

Какие бывают виды запонок

Так что же из себя представляют эти ювелирные изделия в наши дни? Они выступают в роли одного из самых важных аксессуаров в мужском костюме. Запонки — это декоративная застежка, скрепляющая манжет и рукав. Чтобы их надеть, нужна рубашка с французскими манжетами, потому что в таком типе сорочки используются исключительно запонки. Либо вы можете приобрести рубашку с венским типом манжет, в этом случае можно выбирать между запонками и пуговицами. Если хотите сделать свой деловой образ стильным и добавить элегантности и статусности, то такой тип украшений — это отличный вариант! Более того, качественно подобранные ювелирные изделия демонстрируют избирательность в выборе одежды и внимательное отношение к деталям своего имиджа.

Какие бывают виды запонок, как определиться и чем руководствоваться при выборе украшений?

Имеются свои тонкости, на которые нужно обратить внимание в подборе запонок. Главным же признаком, по которому различают данный аксессуар — это симметричность. То есть запонки состоят либо из одинаковых половинок, либо из лицевой украшенной стороны и застежки. Классический облик украшения — это изделие с прикрепленным вращающимся штырьком. Также аксессуары могут отличаться по форме, размеру, дизайну, цвету и используемым материалам. Мужчина может надеть ювелирные яркие запонки, чтобы подчеркнуть свой статус и достаток, либо наоборот — незаметные классические, чтобы придать строгость своему повседневному образу.

Классические запонки

Среди такого многообразия изделий легко запутаться, и подобрать запонки иной раз бывает очень затруднительно. Ведь если надеть не то украшение, можно не улучшить образ, а сделать его совершенно безвкусным. В таком случае как выбрать запонки для мужчины? Первым делом нужно руководствоваться самым важным правилом: все аксессуары должны соответствовать друг другу. Нужно стараться подбирать изделия из одного металла и цветовой гаммы. Стоит обратить внимание на возраст и статус мужчины, который собирается надевать запонки. Важно определиться с ценовой категорией, ведь диапазон достаточно широк и зависит от множества аспектов: материал изготовления, украшение драгоценными камнями, бренд, сложность исполнения, антиквариат.

Как правильно надеть запонки на рубашку

Мы уже выяснили, какой тип сорочек нам подходит, дальше стоит разобраться в том, как же стоит закрепить украшение на руке:

  1. Надев рубашку, сложите манжеты дважды и заверните края назад;
  2. Перед тем, как крепить запонки на манжет, сведите прорези так, чтобы они совпали;
  3. Затем проденьте застежки в отверстия и можете застегивать запонки с другой стороны;
  4. Посмотрите, надежно ли закреплены украшения, ровные ли края манжет, опустите руку, потрясите ею и проверьте, чтобы запонки были прочно зафиксированы.

Если у вас не получается выполнить все действия самому, то попросите кого-нибудь помочь вам, либо можете попробовать продеть заранее запонки в рубашку перед тем как ее надеть. Считается, что правильно носить запонки, когда манжет на полтора сантиметра выглядывает из-под пиджака. Хотя в последнее время это строгое правило нарушается всё чаще.

фото мужской запонки на рубашке

Как надеть запонки на рубашку с пуговицами

Если у вас не нашлось рубашек с французскими или венскими рукавами, не отчаивайтесь — вставить запонки в обычную рубашку с пуговицами тоже возможно. Понадобится только немного терпения и сноровки.

Здесь нужно отметить, придется приготовиться к тому, что после всего такую сорочку можно будет носить только с запонками. Итак, одна прорезь, которая для пуговицы, у нас уже есть. Для второй потребуется срезать пуговицу, и на ее месте наметать петлю. А только потом сделать на этом месте отверстие. Если сначала попробовать сделать прорезь, а уже затем наметку, то выйдет неаккуратно и некрасиво. Учтите, что запонки всегда привлекают внимание, а испорченный манжет будет обязательно всем заметен! Теперь вы знаете, как надеть запонки на рубашку с пуговицами и можете надевать их на свидания, в театр, на деловые презентации или просто по желанию.

Нет сомнений в том, что запонки являются утонченным мужским аксессуаром. Подобранные со вкусом украшения создадут образ изысканного модника. Запонки всегда будут более выигрышно смотреться наряду с обычными пуговицами. Поэтому не бойтесь комбинировать аксессуары под любые события вашей жизни, подчеркивая свою индивидуальность.

Автор: Александр Москалец

Самые популярные виды запонок

Первое впечатление при встрече двух незнакомых людей во многом определяется внешним видом человека, а самые яркие воспоминания оставляет запах. Поэтому перед свиданиями представители сильного пола стараются использовать лучший мужской парфюм по мнению женщин. Правильный выбор одежды и акцент на деталях как в повседневной жизни, так и при посещении особых мероприятий имеет огромное значение. Но иногда бывает недостаточно надеть самый дорогой костюм, белоснежную сорочку и туфли известного бренда.

Для того чтобы подчеркнуть индивидуальный образ, харизму и безупречный вкус мужчина должен использовать аксессуары, в частности, уметь выбирать и носить запонки. Красивое ювелирное изделие, выполняющее функцию крепления двух частей манжета рубашки, никогда не выйдет из моды. Это одно из немногих универсальных украшений в арсенале мужчин, причем не только сторонников классического стиля. Разные виды запонок отличаются по способу крепления, форме, размеру, цвету, типу материала и дизайну. Выделим самые популярные.

Bar

Благодаря простоте и широкому ассортименту, включая цветовое оформление и качество материала, это один из самых востребованных видов запонок. Конструкция состоит из двух одинаковых декоративных шаров, расположенных на обоих концах стержня изделия.

Chain Link

Наиболее традиционный и интересный вариант запонок, который использовался мужчинами еще несколько столетий назад. Оба конца изделия (обычно похожих) соединяются между собой с помощью цепочки. Аксессуар отлично выглядит с двух сторон манжета и подходит для официального стиля под смокинг (дресс-код black tie).

Silk Knot

Этот вид запонок несколько напоминает предыдущий тип с цепочкой. Основное отличие заключается в том, что аксессуар состоит не из металла, а из обычных шелковых узлов. Более эффектно запонки смотрятся, когда декоративные головки на концах сплетены из шелковых нитей разного цвета. Идеальный вариант для повседневного использования с обычными рубашками в неформальной обстановке.

Fabric

Еще один вариант мужских запонок для неофициального или полуофициального стиля одежды. Например, подойдут для похода в ночной клуб или на вечеринку с друзьями в ресторан. Отличительной чертой изделия является наличие «кнопки» с тканевой поверхностью на лицевой стороне. Застежка может быть выполнена в любом стиле.

Whale Back

Один из самых популярных на рынке видов запонок. Аксессуар состоит из плоской декоративной головки на лицевой стороне и специальной застежки на другом конце, напоминающей по форме кита. Механизм очень удобный и простой в использовании. Застежка свободно вращается на стержне, поэтому закрепить запонки на сорочке не составляет труда.

Bullet Back

Очень похожий на предыдущий тип запонок. Стержень между двумя частями изделия представляет собой цельный каркас, внутри которого размещена металлическая застежка в форме «пули». Чтобы зафиксировать запонку на манжете сорочки нужно просто повернуть застежку наружу на 90 градусов. Лицевая сторона аксессуара часто содержит гравировку или украшается драгоценными камнями.

Ball Return

Очень элегантный, красивый и весьма дорогой вид запонок, особенно если изделие выпускается под престижным брендом и содержит такие благородные металлы, как золото или платину. Стержень аксессуара имеет изогнутую форму с небольшой закругленной головкой на внутренней стороне и шаровидной декоративной частью на другой. Идеальный вариант для стильных мужчин.

Locking

Аксессуар с уникальным и инновационным дизайном, заметно отличающимся от всех других видов запонок. В изделие встроен специальный шарнирный механизм, в котором используется система двойной блокировки. После нескольких тренировок разобраться с креплением довольно просто. Поклонникам современного стиля эти запонки точно понравятся.

Button/Stud

Аккуратные запонки небольшого размера с двумя неподвижными частями из одинакового металла. Зафиксировать изделие между петлями манжета на рубашке не так то просто, но крепление весьма прочное и легко регулируется. Подобные запонки часто приобретаются в качестве подарка деловым людям.

На самом деле сегодня существуют десятки типов запонок под разный стиль и финансовые возможности мужчины. Совершенствуйте собственный образ или покупайте красивые изделия своим родным и близким. Изучите для чего нужны запонки в принципе, что поможет грамотно подбирать аксессуар к другой одежде и мероприятию.

Для каждого отдельного случая, например, прохождения собеседования, романтического свидания, деловой встречи или праздничного банкета предусмотрены отдельные виды запонок. Но есть и вполне универсальные варианты. Рассматривайте разные модели и доверяйте личному вкусу.

Мужские запонки, как атрибут стиля

Мужские запонки входят число официальных аксессуаров для костюма, в отличие от браслетов и колец. Основные правила выбора запонок. Запонки, несмотря на отход от повседневности, сохранили актуальность и любой уважающий себя мужчина должен иметь в запасе пару наборов запонок.

История возникновения запонок.

Кто хочет запонки? Кто — бусы?
Чья кровь соскучилась в груди?
Гром грянул! Разбегайтесь, трусы!
Кто похрабрее — выходи!  Rondalla (Готье/Эфрон)
.

Запонки появились в Европе в начале XVII века, во времена правления французского короля Людовика XIV, известного также как «король-солнце».

Запонки появились в Европе в начале XVII века, во времена правления французского короля Людовика XIV, известного также как «король-солнце». Европейские аристократы, до появления запонок, использовали для подвязывания кружевных рукавов сорочек специальные шнурки. Это было неудобно: шнурки рвались и завязать их самостоятельно было большой проблемой. Так появились французские запонки. Они состояли из драгоценных материалов, соединенных друг с другом при помощи короткой цепочки.

Согласно одной из версий, запонки «изобрел» застигнутый на месте любовник, собираясь в спешке, средневековый казанова использовал для закрепления кружевных рукавов застежки для воротника.

Французский писатель Теофиль Готье  (Thophile Gautier) утверждал, что запонки – деталь рыцарских доспехов. Готье появился в Гранд-опере в алой рубашке, манжеты которой были застегнуты серебряными запонками. В одном из писем он поведал: «И что с того, что их шокировал мой вид! Зато уж точно запомнился. Красная рубаха была на Генрихе II, когда ему в глаз вонзили копье … Мне удалось разыскать запонки, похожие на те, что крепили его железные перчатки к стальным рукавам».

Так или иначе, запонки вскоре стали крайне популярны среди джентльменов, но их распространение в широкие массы населения ограничивала слишком высокая цена украшения. Наличие запонок на манжетах выдавало в те времена принадлежность к элитарному обеспеченному обществу.

Запонки самого известного афроамериканского правозащитника и публициста Мартина Лютера Кинга.

На запонках в те времена изготавливали гравюры родовых гербов или украшали портретами дам сердца.

В 1882 год Джордж Кременц получил патент за автоматизацию производства запонок на основе метода изготовления патронов для винтовок. С тех пор запонки стали доступны каждому денди.

В 1924 компания Boyer начала использовать в механизме запонок штырек, вращающийся внутри ножки. Данная конструкция стала столь удачной, что используется по нынешнее время.

Как носить запонки?


Для запонок необходима рубашка с соответствующими манжетами.

Манжета – конец рукава рубашки, представляющая собой отдельный кусок ткани, оборачиваемый вокруг руки (запястья) и фиксируемый в таком положении пуговицей или запонкой.

Манжеты бывают итальянские, венские и французские:

  • Итальянская манжета (спортивная манжета) – самый распространённый вид.
  • Венская манжета (комбинированная манжета) – используется с фраком.
  • Французская манжета (двойная манжета) – формальный вид манжет, одевается и с обычным деловым костюмом, и к смокингу, как единственно возможная форма манжет.

Запонки бывают симметричные и асимметричные, где на одной стороне украшения, а на другой крепление.

Механизм запонок:

  • вращающийся штырёк
  • цепочка
  • застёжка
  • жёсткая сцепка.

Основные правила выбора запонок.

Не забывайте, что запонки одеваются к соответствующему гардеробу.

Смокинг или еще более утонченный вариант – фрак.
 

Под смокинг запонки подбираются под цвет сорочки (белые), хуже черные, под цвет пиджака. Лучше металлические, а не золотые или серебряные. В комбинации с запонками рекомендуется использовать наручные часы с кожаным ремешком, а не металлическим браслетом. Запонки, желательно, не должны быть броскими на фоне гардероба. Денди прошлых веков к белой сорочке и фраку добавляли небольшие золотые запонки.

Классический костюм.

Самый широкий выбор предоставляет классический деловой костюм. Остановиться можно на  любом из возможных вариантов, но запонки должны сочетаться с некоторыми элементами остального гардероба: зажимом для галстука, наручными часами, футляром для визиток, пряжкой ремня, фурнитурой портфеля, кольцом. Как, например, золотой, серебряный, платиновый вариант. Если такой вариант дорог, сейчас используются методы гальванизации при производстве запонок (металл покрывается тонким слоем золота или серебра), что позволяет сократить издержки. Цветные запонки подбираются под цвет сорочки, галстука или нагрудного платка, но немного должен отличаться.

Для молодёжи возможны различные комбинации запонок, но солидным мужчинам рекомендуется ограничиться их «благородным» видом. Серебро, золото, платина прекрасно подходит для таких целей. Очень хорошо смотрятся запонки, украшенные драгоценными камнями. В бизнес сфере отдается предпочтение мужским запонкам изделий известных фирм и украшениям из драгоценных металлов и камней. В некоторых компаниях используются фирменные запонки с собственным логотипом. Не забудьте: носить манжеты расстегнутыми – признак плохого вкуса.

Запонки – милый, забавный аксессуар. Их можно носить со всеми рубашками, у которых есть так называемая «французская манжета». Кстати, у нас во Франции такую манжету называют «мушкетерской». А вы знаете, что по одной из версий, изобрел эту манжету Наполеон по просьбе своих солдат, чтобы они могли утирать нос во время российских морозов?

Красивый миф от Доминика Дормея, владельца французской марки мужской одежды Dormeuil.

Факты о фирмах и коллекциях запонок.

Запонки фирмы Piaget из коллекции Tanagra имеют съемные камни, которые можно менять в зависимости от цвета костюма или аксессуаров. При смене камень держится прочно.

Американские марки запонок Tiffany & Co — Patek Philippe стоят около $1000.

Коллекции марки Di Modolo отличаются присутствием редких камней, совершенством конструкции и практичной функциональностью.

Итальянскую компанию Villa часто называют «королями запонок». История ювелирного дома – это 4 поколения ювелиров, начиная с 1876 года.

Испанский ювелирный дом Carrera y Carrera, занимаясь изысканными ювелирными изделиями и аксессуарами для мужчин, может гордиться коллекцией Circulos de Fuego. Запонки изготовлены из черного оникса и украшены золотыми драконами и стоят $4500.

Немецкий бренд Montblanc, основанный в 1906 году и названный так в честь высочайшей вершины Европы, имеет отличные коллекции запонок, и ценится многими мужчинами.

Основанная в 1990 году марка Tateossian на сегодняшний день широко известна в мире моды. За это время Роберт Татеоссян получил трижды награду British Export Awards for Accessories и получил имя «Короля запонок».

Самые дорогие запонки в мире принадлежат дизайнеру Джанни Виве Сульману. Они изготовлены из золота 750-й пробы с инкрустированными бриллиантами и стоят $40000.

Запонки входят число официальных аксессуаров для костюма, в отличие от браслетов и колец. Мода на них постоянна, и именно такие приятные «мелочи», завершают облик мужчины, позволяя выглядеть достойно и стильно в соответствующей ситуации.

Особенности выбора и носки женской рубашки под запонки

 Желание придать женскому облику нестандартный вид и яркие ощущения, вполне осуществимо благодаря выбору необычных аксессуаров. Такая изюминка как запонки способна достойно украсить любой look, и наделить его индивидуализмом и самобытностью. Использование этих ювелирных украшений было долгое время преимуществом мужского гардероба. В реалиях сегодняшнего дня женские рубашки под запонки выглядят весьма актуальным трендом. Практически у каждого модельера можно встретить в коллекции одежду с манжетами без пуговиц.

 

Почему женщины носят запонки?

 

 Многие предметы мужского гардероба давно привлекают внимание прекрасного пола. Женщины уверенно примеряют к своим нежным образам элементы мужественной атрибутики и успешно переводят их в категорию собственных вещей. Так случилось в свое время с брюками, рубашками, ремнями и шляпами.

 Ошибочным будет полагать, что все женщины, предпочитающие мужские вещи, эмансипированы и авторитарны в стремлении доказать свою силу и состоятельность. В действительности, нетипичные атрибуты более эффективно подчеркивают красоту и утонченность дамских силуэтов. Мужественные запонки, закрепленные в манжетах блузы, акцентируют внимание на великолепии женских рук.

 

Как выглядят запонки для женщин?

 

 Дизайн современных авторов существенно отличается от декоративных работ прошлого века. В создании новых моделей четко прослеживается желание мастеров органично соединить эстетику и функциональность запонок. Сегодня аксессуары утратили универсальное назначение, они имеют четкое гендерное разделение. Изделия для женщин обращают на себя внимание изящными линиями и многообразным исполнением. Среди дамских запонок нередко встречаются настоящие произведения ювелирного искусства.

 Для романтических и утонченных натур предлагаются фантазийные мотивы: бабочки, цветы, стрекозы, бантики, туфельки, сердечки. Деловым и практичным дамам больше подходят сдержанные геометрические формы с драгоценными покрытиями и вкраплениями сверкающих камней.

 Наибольшей оригинальностью отличаются тематические запонки, исполненные в виде скрипичного ключа, музыкальных инструментов, денежных символов, автомобилей и прочих элементов, связанных с профессиональными интересами и хобби.

 

Как закрепить запонки правильно? Фото

 

 Сначала манжеты складывают вместе так, чтобы по нижней кромке образовалась ровная линия, а оба отверстия были строго совмещены. Придерживая манжеты, вставляют запонки и фиксируют их.

 Самый распространенный вид декоративных застежек выглядит в форме капсулы, поворачивающейся вокруг своей оси. Встречаются также запонки с основой, выполненной из такого же материала, что и лицевая часть. Фиксировать их приходится немного дольше, зато получается надежно. Еще один вариант застежек имеет соединение в виде звеньев цепи. Декоративная поверхность таких изделий располагается по обе стороны манжет.

 

Куда можно надевать запонки?

 

 Этот маленький и стильный аксессуар не стоит выбирать, собираясь на танцевальную вечеринку или прогулку с друзьями. Для таких мероприятий обычно надевают коктейльные платья или практичную одежду уличного стиля.

 Запонки уместно выглядят в ансамбле со строгими костюмами, предназначенными для деловых, торжественных встреч и офисной обстановки. К ним надевают рубашки с манжетами, слегка выглядывающими из-под края рукавов. Наличие в одежде необычных красивых застежек подчеркивает в девушке хороший вкус и чувство стиля.

 

Особенности женских рубашек

 

 Модели под запонки не относятся к категории часто используемых вещей. Обычно их приобретают девушки, выбирающие одежду определенного стиля, или сотрудницы компаний, стремящиеся внести разнообразие в повседневные образы сурового дресс кода.

 Женская рубашка с запонками отличается от типовых моделей особым исполнением удлиненных манжет, которые называют французскими. На них отсутствуют пуговицы, зато имеются две прорези для закрепления застежек. В женской моде допускаются рубашки с французскими манжетами обычной длины рукавов и на 3/4.

 Чтобы избежать лишних расходов, можно с помощью нехитрых манипуляций самостоятельно превратить любимую блузку в рубашку на запонках. Для этого следует срезать пуговицы, а на их месте сделать прорез, края которого аккуратно обработать на швейной машине.

 

Чем отличаются женские рубашки на запонках от мужских?

 

 Прежде всего, в глаза бросается разница в крое. Мужские сорочки отличает традиционное классическое исполнение с одним нагрудным карманом. Женские варианты имеют приталенные формы, подчеркивающие изящные линии фигуры. Для стройных и худощавых девушек на верхней части одежды предлагаются декоративные элементы – рюши, воланы, кружева.

 Тип ткани, плотность, фактурность допускаются самые разнообразные для обоих видов рубашек. Что касается цвета, то здесь также нет ограничений. Белая рубашка всегда считалась типичной для классического стиля. Мужчинам также предлагается умеренный выбор светлых рубашек пастельных оттенков. Допустимы слегка размытые рисунки в виде тонкой полоски. Для женщин дизайнеры предлагают гораздо больше вариантов расцветок и принтов.

 Мужская мода строго требует, чтобы манжеты с запонками выступали из-под рукава фрака или пиджака на 1,5-2 сантиметра. Деловой образ должен быть строгим и лаконичным. К девушкам мода более снисходительна и не настаивает на обязательном сочетании с пиджаком или жакетом. Оригинальная рубашка с запонками, как самостоятельный вид одежды, позволяет создавать более романтичные и женственные образы.

 Имеется еще одно требование, одинаковое для всех – надевая запонки, следует забыть об остальных аксессуарах, особенно золотых. В противном случае в луке будет присутствовать слишком много блеска. Из украшений допускаются некрупные серьги, короткая нить жемчуга, аккуратный клатч или шелковый галстук-бант.

Запонки на рубашке являются стильным мужским аксессуаром, который сможет подчеркнуть индивидуальность и изысканность вашего образа

рекомендуем вам почитать

Запонки являются одной из немногих деталей в мужском гардеробе, которая позволяет сделать образ индивидуальным и стильным. Эти стильные детали одежды подходят абсолютно всем представителям сильного пола. В связи с этим желательно иметь в гардеробе сразу несколько подобных аксессуаров для разных ситуаций. В современном мире запонки давно стали визитной карточкой настоящего джентльмена. Они позволяют сделать образ более элегантным и утонченным. Стильная рубашка под запонки является любимым предметом гардероба многих известных личностей, таких как Джордж Клуни, Пирс Броснан, Орландо Блум, Дэниел Крэйг, Брэд Питт и другие.

Мужские сорочки под запонки могут иметь три типа манжет:

Венские или повседневные - имеют традиционные манжеты, для застегивания которых вместо пуговиц используются запонки. Эти модели можно носить ежедневно, а не только на торжественные мероприятия.

Французские или двойные - отличаются широкими манжетами, которые состоят из двух слоев с отворотом. Они предназначаются специально для запонок. Рубашка с такими манжетами отлично подойдет для торжественных мероприятий.

Спортивные или комбинированные - можно носить как с пуговицами, так и с запонками. Предназначаются в большей степени для тех мужчин, которые не хотят все время ходить с этими аксессуарами, а собираются чередовать их с пуговицами.

С какими рубашками сочетаются запонки?

Идеальным вариантом является специальная рубашка под запонки, которая имеет двойную манжету. Такая модель еще называется французская манжета. Сюда идеально подойдет симметричный вариант запонки. Кроме того, запонки будут хорошо смотреться на элегантной белой рубашке с одинарной манжетой, не имеющей пуговиц. Для этих случаев наилучшим вариантом станут ассиметричные аксессуары. Есть также и сорочки с комбинированной манжетой одинарного типа, где есть как прорези для запонок, так и пуговицы. Какую бы сорочку вы не выбрали, она должна иметь такую длину рукава, чтобы он выглядывал из-под пиджака на несколько сантиметров. Это делается для того, чтобы эти дорогие аксессуары становились видны только при сгибании руки. В этом и будет заключаться основной шарм, поскольку дорогие мужские аксессуары не нужно выставлять напоказ. Они должны появляться случайно и подтверждать богатство образа.

Виды запонок

По материалу:

  • металлические;
  • серебряные;
  • золотые;
  • сделанные из медицинской стали;
  • тканевые;
  • деревянные.

По симметричности:

  • асимметричные - лицевая сторона украшена, а на обратной стороне находится застежка;
  • симметричные - изделие украшено с обеих сторон.

По механизму крепления:

  • завинчивающийся штырь;
  • Т-образная застежка;
  • цепочка.

По стилю:

  • универсальные, подходящие для любой одежды и ситуации;
  • шлифованные металлические, которые можно надевать на деловые мероприятия или на работу;
  • изделия, сделанные из дорогих металлов, которые подойдут для самых торжественных мероприятий.

Как подобрать запонки к рубашке?

В первую очередь, запонки подбирают к галстуку, рубашке, костюму и часам, учитывая общий стиль. Для делового стиля отличным вариантом станут эти мужские аксессуары, сделанные из палладия, золота, платины или китайского лака. Еще лучше, если они будут инкрустированы драгоценными камнями. В сочетании со смокингом не лучшим образом будут смотреться чисто серебряные или золотые изделия, так как они будут слишком выделяться. Выбирая запонки, важно помнить об их сочетании с другими аксессуарами. Прежде всего, нужно учитывать модель часов. Именно поэтому многие производители элитных швейцарских часов выпускают и запонки к ним. К наручным часам с серебряным или золотым ремешком и циферблатом подойдут изделия, сделанные из соответствующих материалов. В то же время, мужские часы с кожаным ремешком неплохо сочетаются с аксессуарами из золота, каучука или кожи.

Как правильно закрепить запонки?

Для крепления запонки нужно продеть ее в петлю на манжете и надежно зафиксировать в ней. При этом не нужно бояться, что аксессуар выпадет из манжеты. Если вы имеете дело с французской манжетой, то никогда не проглаживайте изгиб на ней. Перед тем, как вставлять запонки, такую манжету просто подворачивают. Самым удобным механизмом для крепления является Т-образная застежка. Чтобы закрепить изделие с таким механизмом, достаточно просто повернуть ее вдоль своей оси и все.

Куда носить?

Запонки можно носить практически на любое официальное мероприятие, начиная от дня рождения и заканчивая серьезной презентацией. Эти мужские аксессуары подходят для деловых встреч, романтических свиданий, походов в театр и так далее. Наиболее правильно надевать их на важные деловые встречи, где необходимо произвести впечатление на коллег. На таком мероприятии сразу отметят человека, который уделяет должное внимание своему внешнему виду, имеет изысканный вкус и чувство стиля.

Основываясь на рекомендациях и правилах выбора запонок можно с легкостью дополнить образ элегантным аксессуаром, подчеркнув собственный стиль. В интернет-магазине Світ срібла найдете запонки из серебра, стали, с чернением, золотыми пластинами, драгоценными камнями, керамикой, эмалью, которые выгодно продемонстрируют чувство стиля.

Запонки

Запустите запонки из командной строки следующим образом:

запонки [опции]

Ниже приводится подробное описание параметров, используемых для управления запонками:

### Аргументы

Файл выравниваний чтения RNA-Seq в формате SAM. SAM - это стандартное выравнивание для короткого чтения, которое позволяет выравнивателям прикреплять пользовательские теги к отдельным выравниваниям, а Cufflinks требует, чтобы предоставленные вами выравнивания содержали некоторые из этих тегов.См. Дополнительные сведения в разделе «Форматы ввода».

### Запонки Общие параметры

-ч / –помощь

Распечатывает справочное сообщение и закрывает

-g / –GTF-guide

Указывает Cufflinks использовать прилагаемую справочную аннотацию к файлу GFF для руководства сборкой RABT. Справочные стенограммы будут выложены ложным считыванием для предоставления дополнительной информации в сборке. Выходные данные будут включать все контрольные транскрипты, а также любые новые гены и изоформы, которые будут собраны.

-M / –mask-file <маска. (Gtf / gff)>

Указывает Cufflinks игнорировать все чтения, которые могли быть получены из стенограмм в этом файле GTF. Мы рекомендуем включать в этот файл любую аннотированную рРНК, митохондриальные транскрипты и другие многочисленные транскрипты, которые вы хотите игнорировать при анализе. Из-за различной эффективности методов обогащения мРНК и наборов для истощения рРНК маскирование этих транскриптов часто улучшает общую надежность оценок количества транскриптов.

-b / –frag-bias-corrective <геном.fa>

Предоставление запонок с файлом multifasta с помощью этой опции дает указание запустить наш новый алгоритм обнаружения и исправления смещения, который может значительно повысить точность оценок количества расшифровок. Подробнее см. Как работают запонки.

-u / –множественное чтение-правильное

Указывает Cufflinks выполнить процедуру начальной оценки для более точного сопоставления показаний веса с несколькими участками генома. Подробнее см. Как работают запонки.

–библиотечный

См. Типы библиотек

–библиотека-норма-метод

См. Методы нормализации библиотеки

### Расширенные параметры оценки численности

-m / –frag-len-mean

Это ожидаемая (средняя) длина фрагмента. По умолчанию 200 б.п.

Примечание. Cufflinks теперь изучает среднюю длину фрагмента для каждого файла SAM, поэтому использование этой опции больше не рекомендуется при чтении с парным концом.

-s / –frag-len-std-dev

Стандартное отклонение для распределения по длинам фрагментов. По умолчанию - 80 бп.

Примечание. Cufflinks теперь изучает стандартное отклонение длины фрагмента для каждого файла SAM, поэтому использование этой опции больше не рекомендуется при чтении с парным концом.

-N / –норма верхнего квартиля

С этой опцией Cufflinks нормализуется по верхнему квартилю количества фрагментов, отображаемых в отдельные локусы, а не по общему количеству секвенированных фрагментов.Это может повысить надежность дифференциальной экспрессии, требующей меньшего количества генов и транскриптов.

- норма всего совпадений

С этой опцией Cufflinks считает все фрагменты, включая те, которые не совместимы с какой-либо справочной транскрипцией, в число сопоставленных совпадений, используемых в знаменателе FPKM. Этот параметр можно комбинировать с -N / –upper-qutile-norm. По умолчанию он активен.

–compatible-hits-norm

С этой опцией Cufflinks считает только те фрагменты, которые совместимы с некоторой справочной расшифровкой, в число сопоставленных совпадений, используемых в знаменателе FPKM.Этот параметр можно комбинировать с -N / –upper-qutile-norm. По умолчанию он неактивен и может использоваться только в сочетании с

.

–GTF

Использование с RABT или ab initio сборкой не поддерживается

–max-mle-iterations

Устанавливает количество итераций, разрешенных во время оценки численности методом максимального правдоподобия. По умолчанию: 5000

–max-bundle-frags

Устанавливает максимальное количество фрагментов, которые может иметь локус перед пропуском.Пропущенные локусы перечислены в skipped.gtf. По умолчанию: 1000000

–неэффективная коррекция длины

Cufflinks не будет использовать свою «эффективную» нормализацию длины для расшифровки FPKM.

- без коррекции длины

Запонки вообще не нормализуют количество фрагментов по длине транскрипта. Используйте эту опцию, когда количество фрагментов не зависит от размера количественно оцениваемых функций (например, для небольших библиотек РНК, где не происходит фрагментация, или секвенирования с тремя простыми концами, где все отобранные фрагменты РНК по существу имеют одинаковую длину).Экспериментальный вариант, используйте с осторожностью.

### Дополнительные параметры сборки

-L / –этикетка

Cufflinks будет сообщать о трансфрагментах в формате GTF с префиксом, заданным этой опцией. Префикс по умолчанию - «CUFF».

-F / –мин-изоформ-фракция <0,0-1,0>

После вычисления количества изоформ для гена Cufflinks отфильтровывает транскрипты, которые, по его мнению, имеют очень низкую распространенность, потому что изоформы, экспрессируемые на очень низких уровнях, часто не могут быть надежно собраны и могут даже быть артефактами не полностью сплайсированных предшественников обработанных транскриптов.Этот параметр также используется для фильтрации интронов, которые имеют гораздо меньше поддерживающих их сплайсинговых выравниваний. По умолчанию используется 0,1 или 10% наиболее распространенной изоформы (основной изоформы) гена.

-j / –пре-мРНК-фракция <0,0-1,0>

Некоторые протоколы RNA-Seq производят значительное количество считываний, которые происходят из не полностью сплайсированных транскриптов, и эти считывания могут затруднять сборку полностью сплайсированных мРНК. Cufflinks использует этот параметр, чтобы отфильтровать совпадения, которые лежат в интронных интервалах, подразумеваемых сращиванием совмещений.Минимальная глубина покрытия в интронной области, охватываемой выравниванием, делится на количество склеенных считываний, и если результат ниже, чем значение этого параметра, интронные выравнивания игнорируются. По умолчанию 15%.

-I / –max-длина интрона

Максимальная длина интрона. Запонки не будут сообщать о транскриптах с интронами, длина которых превышает указанное, и игнорируют сопоставления SAM с операциями REF_SKIP CIGAR, длина которых превышает указанное. По умолчанию 300 000.

-a / –junc-alpha <0,0-1,0>

Альфа-значение для биномиального теста, используемого во время фильтрации ложноположительного совмещения сращиванием. По умолчанию: 0,001

-A / –маленькая анкерная фракция <0,0-1,0>

Склеенные чтения, длина которых на каждой стороне соединения меньше указанного процента, считаются подозрительными и могут быть отфильтрованы перед сборкой. По умолчанию: 0,09.

–min-frags-per-transfrag

Собранные трансфрагменты, поддерживаемые меньшим количеством выровненных фрагментов RNA-Seq, не сообщаются.По умолчанию: 10.

- допуск на вылет

Число п.н., разрешенных для ввода в интрон транскрипта при определении того, отображается ли прочитанный или другой транскрипт или совместим с ним. Значение по умолчанию - 8 б.п. на основе параметров Bowtie / TopHat по умолчанию.

–max-bundle-length

Максимальная длина генома, разрешенная для данного пучка. По умолчанию - 3 500 000 б.п.

–мин-длина интрона

Минимальный размер интрона, разрешенный в геноме.По умолчанию - 50 б.п.

–trim-3-avgcov-thresh

Минимальное среднее покрытие, необходимое для попытки обрезки 3 фута. По умолчанию - 10.

.

–trim-3-dropoff-frac

Доля среднего покрытия, ниже которой нужно обрезать 3 ’конец собранной транскрипции. По умолчанию - 0,1.

–макс-многопоточность <0,0–1,0>

Фракция, поддерживающая считывания при трансфрагментации, которая может быть многократно отображена в геноме.Расшифровка, состоящая из более чем этой части, не будет сообщена ассемблером. По умолчанию: 0,75 (75% и более многопоточности подавляются).

- радиус перекрытия

Transfrags, которые разделены меньшим, чем это расстояние, объединяются вместе, и разрыв заполняется. По умолчанию: 50 (в битах).

### Опции сборки расширенной справочной аннотации (RABT)

Примечание. Эти параметры действуют только при использовании вместе с -g / –GTF-guide.

–3-допуск на вылет

Число п.о., которые могут выступать над 3 ’концом эталонного транскрипта при определении, следует ли слить с ним собранный транскрипт (т. Е. Собранный транскрипт не является новым). По умолчанию - 600 б.п.

- допуск на вылет интрона

Число п.н., разрешенное для входа в интрон эталонного транскрипта при определении, следует ли слить с ним собранный транскрипт (т. Е. Собранный транскрипт не является новым).По умолчанию - 50 б.п.

- без ложных считываний

Этот параметр отключает мозаичное отображение стенограмм ссылок с ложными считываниями. Используйте это, если вы хотите использовать только чтение последовательности в сборке, но не хотите выводить собранные транскрипты, которые лежат в ссылочных транскриптах. Все справочные стенограммы во входной аннотации также будут включены в выходные.

### Расширенные параметры поведения программы

-v / –verbose

Печать большого количества обновлений статуса и другой диагностической информации.

-q / -тихий

Подавлять сообщения, кроме серьезных предупреждений и ошибок.

- без проверки обновлений

Отключает автоматическую процедуру, которая связывается с сервером Cufflinks для проверки наличия более новой версии.

## Запонки Входные файлы

Cufflinks принимает на вход текстовый файл с выравниванием SAM или двоичный файл SAM (BAM). Подробнее о формате SAM см. В спецификации. Устройство отображения чтения RNA-Seq TopHat производит вывод в этом формате и рекомендуется для использования с запонками.Однако Cufflinks будет принимать выравнивания SAM, созданные любым устройством отображения чтения. Вот пример выравнивания, которое принимают запонки:

s6.25mer.txt-913508 16 chr1 4482736 255 14M431N11M * 0 0 \
   CAAGATGCTAGGCAAGTCTTGGAAG IIIIIIIIIIIIIIIIIIIIIIIII NM: i: 0 XS: A: -
 

Обратите внимание на использование пользовательского тега XS. Этот атрибут, который должен иметь значение «+» или «-», указывает, из какой цепи была получена РНК, которая произвела это чтение. Хотя этот тег может быть применен к любому выравниванию, в том числе к несращенным, он должен присутствовать для всех записей совмещенного выравнивания (тех, которые имеют операцию «N» в строке CIGAR).Файл SAM, предоставленный Cufflinks, должен быть отсортирован по ссылочной позиции. Если вы выровняли свои чтения с TopHat, ваши выравнивания уже будут правильно отсортированы. Если вы использовали другой инструмент, вы можете убедиться, что они правильно отсортированы следующим образом:

  sort -k 3,3 -k 4,4n hits.sam> hits.sam.sorted  

## Запонки O

Запонки на заказ | Запонки на заказ онлайн

У меня есть любимая фотография.Вы можете использовать это в моем дизайне?

Конечно. Маркеры могут использовать метод офсетной печати, подходящий для фотографий. Во избежание нечетких или нечетких отпечатков мы настоятельно рекомендуем использовать фотографии или иллюстрации в формате JPEG, TIFF, AI или PSD с высоким разрешением и разрешением более 300 точек на дюйм.

Для других красочных дизайнов наша команда дизайнеров может оказать бесплатную помощь в оцифровке / векторизации этих изображений. Иногда этот процесс увеличивает время обработки.

Могу ли я получить цифровую копию дизайна?

Да. После каждой бесплатной консультации по дизайну мы будем отправлять вам четкую цифровую копию дизайна. Если он не идеален, дайте нам знать, и мы не успокоимся, пока он не станет идеальным. Когда вы будете довольны, мы отправим одобренный вами дизайн на завод для производства.

дизайнов будут отправлены через 1-2 рабочих дня после подтверждения оплаты.По запросу дизайн также может быть отправлен до оплаты.

Могу я сделать любую форму, которую хочу?

Наши линии коллекций более универсальны, чем вы ожидаете - просто спросите своего творческого специалиста, и вы можете быть удивлены тем, что мы можем сделать.

Есть ли ограничения на количество цветов, которые я могу использовать?

Вовсе нет.Мы можем делать неограниченное количество цветов, но на каждые девять цветов нити стоимость и скорость вашего продукта удваиваются. Однако для большинства дизайнов наших клиентов девяти цветов более чем достаточно. Вам также может быть интересна нашивка с принтом, если вы действительно хотите что-то исключительно красочное.

Что такое «компенсация»?

Смещение - это техника в дизайне, при которой создается впечатление, что изображение имеет тень, дублируя изображение и помещая его позади дизайна и сбоку под углом.

Могу ли я сделать один и тот же товар разных цветов и получить заказ по той же цене?

Чаще всего да. Это зависит от того, какие цвета и стили вы хотите заменить, но ваш креативный специалист всегда настроит порядок наиболее экономичным способом.

Сколько цветов может иметь мой дизайн?

Рисунки фартуков с трафаретной печатью могут получать максимум 10 цветов для традиционной точечной трафаретной печати (только сплошные цвета, без градиентов).

Вышивка может содержать до девяти цветов на одно место, но для ясности мы советуем не более пяти.

На один фартук можно наносить как трафаретную печать, так и вышивку. Просто, но блестяще, как бекон в шоколаде.

Полноцветная печать - единственный вариант, позволяющий получать неограниченное количество цветов и цветовых градиентов. Полноцветная печать сублимацией красителя доступна в небольших количествах только в одном стиле / артикуле, но мы также предлагаем вырезать и сшить фартуки - хотя обычно требуется большее количество, прежде чем они станут экономичным выбором с высочайшим уровнем настройки.

Могу ли я получить трафаретную печать или термотрансферную печать на моих шапках?

Нет. Причина, по которой мы не разрешаем эту опцию, заключается в том, что трафаретная печать или теплопередача на трикотажной ткани выглядят ужасно в тот момент, когда вы начинаете ее носить, и трескается, когда ткань под ней движется и растягивается. Рисунки, которые вы здесь, представляют собой либо заплатки, которые могут двигаться и растягиваться вместе с тканью, либо рисунки, которые фактически вяжутся в ткань.Это действительно возможно, как скажут некоторые из наших конкурентов, но вы не захотите носить его больше одного раза.

Могу ли я отправить готовую работу?

Совершенно верно! Несмотря на то, что у нас есть команда дизайнеров мирового уровня, которые могут создавать невероятные изображения с нуля, мы также знаем, что у нас есть невероятно креативные клиенты. Если вам не нужна помощь в дизайне, вы можете отправить готовые графические файлы для подготовки к производству.

Что делать, если меня не устраивает дизайн?

Мы рады внести столько изменений, сколько необходимо, чтобы сделать ваш дизайн идеальным. Вы сможете общаться с нашей командой на протяжении всего процесса через специальную панель управления для клиентов, которая позволяет делать заметки непосредственно в своем дизайне. Обратите внимание, что длительный процесс редактирования увеличит время вашей общей производственной шкалы, поэтому четкие описания необходимы для минимизации количества необходимых правок.Вы даже можете загрузить изображения или эскизы, чтобы показать нам свою идею.

Что мне нужно отправить, чтобы начать мой заказ?

Вам необходимо заполнить форму выше, чтобы мы получили общую информацию о вашем заказе. Вы также можете отправить иллюстрации, эскизы, справочные изображения и т. Д., Чтобы мы лучше понимали ваше видение. Если нам потребуется дополнительная информация, ваш представитель свяжется с вами.

Могу ли я отправить готовую работу?

Совершенно верно! Несмотря на то, что у нас есть команда дизайнеров мирового уровня, которые могут создавать невероятные изображения с нуля, мы также знаем, что у нас есть невероятно креативные клиенты. Если вам не нужна помощь в дизайне, вы можете отправить готовые графические файлы для подготовки к производству.

Какие мокапы мне ожидать?

Вы получите цифровой макет, как только наша команда создаст ваш дизайн.После того, как вы утвердите свой макет, мы изготовим физический образец ЭЛЕМЕНТА и отправим вам изображения с завода. Кроме того, вы можете запросить получение физического образца по почте - обратите внимание, что это добавит времени к вашему общему графику производства, а также к стоимости доставки.

Что делать, если меня не устраивает дизайн?

Мы будем рады внести столько правок, сколько необходимо, чтобы сделать ваш дизайн идеальным.Вы сможете общаться с нашей командой на протяжении всего процесса через специальную панель управления для клиентов, которая позволяет делать заметки непосредственно в вашем дизайне. Обратите внимание, что длительный процесс редактирования увеличит время вашего производства, поэтому, пожалуйста, помогите нам с четким описанием ваших потребностей. Вы даже можете загружать изображения или эскизы.

Лучшие 7 типов запонок для мужчин

Запонки - это украшения для мужчин и мальчиков, которые используются для закрепления манжетов рубашек.Они являются альтернативой пуговицам, которые обычно пришиваются на манжеты рубашек.

Запонки - отличный способ добавить индивидуальности костюму или классической рубашке. Благодаря такому количеству новых стилей они также могут быть способом поддержать ваши любимые команды, продемонстрировать ваше уникальное чувство стиля или просто завершить образ. Итак, здесь мы собрали все типы запонок. Если вы любите собирать запонки, то вам стоит приобрести футляр для запонок , чтобы держать их в порядке.

Аксессуар, который преобразит вашу официальную одежду

Типы запонок

  1. Запонка Bullet Back
  2. Запонки Whale Back
  3. Запонки с фиксированной спинкой
  4. Запонки звено цепи
  5. Запонка с возвратным шариком
  6. Запонки двойного действия с замком
  7. Запонки с узлом

1.Запонка Bullet Back

Эти запонки классифицируются по маленькому цилиндру, который устанавливается между двумя короткими перемычками и для фиксации переворачивается на 90 градусов. Они идеально подходят для официальных мероприятий или в офисе. Также называется Torpedo или Toggle Closure Cufflink .

2. Запонки на спину кита

Стиль хвоста кита похож на обычную подкладку пули. У них плоская голова, прямой столб и «китовый хвост», который полностью упирается в столб.Они очень простые, а их большой столб и механизм закрытия делают их удобными в использовании. Также называется Whale Tail Cufflink или Swivel Cufflink .

3. Запонка фиксированная сзади

В этой конструкции нет движущихся частей. Может оказаться, что их сложно носить, но они оказываются более прочными. Также называется Stub Cufflink или Button Style Cufflink

4. Запонка звено цепи

Судя по названию, два конца запонки прикреплены к цепочке.Эта ссылка позволяет ослабить манжету в соответствии с вашими предпочтениями и легко застегивается. Многие запонки из звеньев цепочки также двусторонние, но концы соединены цепочкой.

5. Запонка с возвратным шариком

Ball Return Cufflink имеет изогнутую стойку с маленьким тяжелым шариком напротив декоративной головки. Запонки с возвратным шаром можно найти как в вариантах с цепочкой, так и с фиксированной застежкой. Лица меняются в зависимости от дизайна, но задняя часть всегда будет отличаться формой шара.

6. Запонка двойного действия с фиксатором

Запонки двойного действия с замком имеют шарнирный механизм, похожий на застежку металлического ремешка для часов. Запонки легко вставляются, складываются и фиксируются. Он имеет складную систему блокировки двойного действия.

7. Запонки с узлом

Запонки с узлами работают так же, как и звенья цепи, с коротким шнуром, соединяющим две головки. Они отлично подходят для неформальных мероприятий, запонка с узлом придает яркость и простоту использования.

Выберите запонки из этого широкого ассортимента и сделайте себя более элегантным. Никогда не знаешь, может быть, ты лучше всех одет среди друзей или семьи. Итак, выбирайте подходящие запонки, исходя из своих предпочтений и стиля.
Собираетесь ли вы на важное собеседование или ужин при свечах? Не упустите возможность надеть запонки. Это то, что отражает ваше отношение к человеку.

Связанные

Что вы видите, покупая футляр-держатель для запонок? Может быть, ваш любимый цвет или что-то еще, что хорошо сочетается с вашим гардеробом.Хотя эти критерии могут показаться вам наиболее важными характеристиками, на которые следует обратить внимание, вы все равно рискуете приобрести запонки…

9 июля 2015 г.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *